Merge branch 'main' into copilot/add-playfair-encoding

Author: dhondta

.github/workflows/python-package.yml

@@ -18,12 +18,14 @@ jobs:
     runs-on: ubuntu-latest
     outputs:
       package: ${{ steps.pkg.outputs.package }}
+      pypi_url: ${{ steps.pkg.outputs.pypi_url }}
     steps:
       - name: Compute package name from the repository's
         id: pkg
         run: |
           name="${GITHUB_REPOSITORY##*/}"
           echo "package=${name#python-}" >> $GITHUB_OUTPUT
+          echo "pypi_url=https://pypi.org/p/${name#python-}" >> $GITHUB_OUTPUT
   build:
     needs: prepare
     runs-on: ${{ matrix.os }}
@@ -63,7 +65,7 @@ jobs:
     - uses: actions/checkout@v5
       with:
         fetch-depth: 0
-        ref: ${{ github.head_ref || github.ref_name }}
+        ref: ${{ (github.event_name == 'pull_request' || github.event_name == 'pull_request_target') && github.event.pull_request.head.sha || github.sha }}
     - name: Set up Python ${{ env.python_version }}
       uses: actions/setup-python@v6
       with:
@@ -96,6 +98,9 @@ jobs:
         git commit -m "Update coverage badge"
         git push origin coverage-badge --force
   deploy:
+    environment:
+      name: pypi
+      url: ${{ needs.prepare.outputs.pypi_url }}
     runs-on: ubuntu-latest
     needs: [prepare, coverage]
     steps:

README.md

@@ -43,7 +43,7 @@ $ echo -en "test" | codext encode base100
 👫👜👪👫
 ```
 
-### Chaining codecs
+### :chains: Chaining codecs
 
 ```sh
 $ echo -en "Test string" | codext encode reverse
@@ -62,7 +62,7 @@ $ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTG
 test string
 ```
 
-### Using macros
+### :twisted_rightwards_arrows: Using macros
 
 ```sh
 $ codext add-macro my-encoding-chain gzip base63 lzma base64
@@ -79,7 +79,9 @@ $ codext list macros
 example-macro
 ```
 
-## :computer: Usage (base CLI tool) <a href="https://twitter.com/intent/tweet?text=UnBase%20-%20Decode%20any%20multi-layer%20base-encoded%20string.%0D%0APython%20tool%20for%20decoding%20any%20base-encoded%20string,%20even%20when%20encoded%20with%20multiple%20layers.%0D%0Ahttps%3a%2f%2fgithub%2ecom%2fdhondta%2fpython-codext%0D%0A&hashtags=python,base,encodings,codecs,cryptography,stegano,steganography,ctftools"><img src="https://img.shields.io/badge/Tweet%20(unbase)--lightgrey?logo=twitter&style=social" alt="Tweet on unbase" height="20"/></a>
+## :desktop_computer: Usage (`baseXX` CLI tools) <a href="https://twitter.com/intent/tweet?text=UnBase%20-%20Decode%20any%20multi-layer%20base-encoded%20string.%0D%0APython%20tool%20for%20decoding%20any%20base-encoded%20string,%20even%20when%20encoded%20with%20multiple%20layers.%0D%0Ahttps%3a%2f%2fgithub%2ecom%2fdhondta%2fpython-codext%0D%0A&hashtags=python,base,encodings,codecs,cryptography,stegano,steganography,ctftools"><img src="https://img.shields.io/badge/Tweet%20(unbase)--lightgrey?logo=twitter&style=social" alt="Tweet on unbase" height="20"/></a>
+
+Playing with base encodings.
 
 ```session
 $ echo "Test string !" | base122
@@ -106,16 +108,73 @@ $ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Te
 Test string !
 ```
 
-## :computer: Usage (Python)
+## :computer: Usage (CLI)
+
+Listing codecs.
+
+```session
+$ codext list encodings
+a1z26                      adler32               affine             alternative-rot        ascii           
+atbash                     autoclave             bacon              barbie                 base            
+base1                      base2                 base3              base4                  base8           
+<<snipped>>
+```
+
+Finding a codec based on a name.
+
+```session
+$ codext search bitcoin
+base58
+```
+
+Encoding a string.
 
-Getting the list of available codecs:
+```sesssion
+$ echo -en "This is a test" | codext encode polybius
+44232443 2443 11 44154344
+```
+
+Encoding a file.
+
+```session
+$ echo -en "this is a test" > to_be_encoded.txt
+$ codext encode base64 < to_be_encoded.txt > text.b64
+$ cat text.b64 
+dGhpcyBpcyBhIHRlc3Q=
+```
+
+Chaining codecs.
+
+```session
+$ echo -en "mrdvm6teie6t2cq=" | codext encode upper | codext decode base32 | codext decode base64
+test
+```
+
+Iteratively guessing decodings.
+
+```session
+$ echo -en "test" | codext encode base64 gzip | codext guess
+Codecs: gzip
+dGVzdA==
+$ echo -en "test" | codext encode base64 gzip | codext guess gzip -i base
+Codecs: gzip, base64
+test
+```
+
+
+## :snake: Usage (Python)
+
+Getting the list of available codecs.
 
 ```python
 >>> import codext
 
 >>> codext.list()
 ['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']
 
+Playing with some base encodings.
+
+```python
 >>> codext.encode("this is a test", "base58-bitcoin")
 'jo91waLQA1NNeBmZKUF'
 
@@ -130,7 +189,21 @@ Getting the list of available codecs:
 
 >>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
 'this is a test'
+```
+
+Playing with some cryptography-based codecs.
 
+```python
+>>> codext.encode("This is a test !", "vigenere-MYSECRETKET")
+'Ffaw kj e mowm !'
+
+>>> codext.encode("This is a test !", "autoclave-SECRET")
+'Llkj ml t amkb !'
+```
+
+Encoding/decoding with various other codecs.
+
+```python
 >>> for i in range(8):
         print(codext.encode("this is a test", "dna-%d" % (i + 1)))
 GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
@@ -158,30 +231,6 @@ CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
 	f.read()
 'this is a test'
 
->>> codext.decode("""
-      =            
-              X         
-   :            
-      x         
-  n  
-    r 
-        y   
-      Y            
-              y        
-     p    
-         a       
- `          
-            n            
-          |    
-  a          
-o    
-       h        
-          `            
-          g               
-           o 
-   z      """, "whitespace-after+before")
-'CSC{not_so_invisible}'
-
 >>> print(codext.encode("An example test string", "baudot-tape"))
 ***.**
    . *
@@ -282,15 +331,21 @@ This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `ba
 
 - [X] `affine`: aka Affine Cipher
 - [X] `atbash`: aka Atbash Cipher
+- [X] `autoclave`: aka Autoclave/Autokey Cipher (variant of Vigenere Cipher)
 - [X] `bacon`: aka Baconian Cipher
 - [X] `barbie-N`: aka Barbie Typewriter (*N* belongs to [1, 4])
+- [X] `beaufort`: aka Beaufort Cipher (variant of Vigenere Cipher)
 - [X] `citrix`: aka Citrix CTX1 password encoding
 - [X] `playfair`: aka Playfair Cipher
+- [X] `phillips`: aka Phillips Cipher (polyalphabetic block cipher with 8 key squares)
 - [X] `polybius`: aka Polybius Square Cipher
 - [X] `railfence`: aka Rail Fence Cipher
 - [X] `rotN`: aka Caesar cipher (*N* belongs to [1,25])
 - [X] `scytaleN`: encrypts using the number of letters on the rod (*N* belongs to [1,[)
 - [X] `shiftN`: shift ordinals (*N* belongs to [1,255])
+- [X] `trithemius`: aka Trithemius Cipher (variant of Vigenere Cipher)
+- [X] `vic`: aka VIC Cipher
+- [X] `vigenere`: aka Vigenere Cipher
 - [X] `xorN`: XOR with a single byte (*N* belongs to [1,255])
 
 > :warning: Crypto functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.

docs/pages/enc/crypto.md

@@ -71,6 +71,23 @@ It implements the monoalphabetic substitution cipher used for the Hebrew alphabe
 
 -----
 
+### Autoclave/Autokey Cipher
+
+This is a variant of the [Vigenere Cipher](#vigenere-cipher) using a key stream generated from the primer key and the message appended.
+
+**Codec** | **Conversions** | **Aliases** | **Comment**
+:---: | :---: | --- | ---
+`autoclave` | text <-> Autoclave ciphertext | `autoclave-cipher`, `autokey` | 
+
+```python
+>>> codext.encode("This is a test !", "autoclave-test")
+'Mlal bz i lmkt !'
+>>> codext.decode("Mlal bz i lmkt !", "autokey_cipher-test")
+'This is a test !'
+```
+
+-----
+
 ### Baconian Cipher
 
 It support only letters.
@@ -109,6 +126,25 @@ It implements the cipher for its 4 different keys.
 
 -----
 
+### Beaufort Cipher
+
+This is a variant of the [Vigenere Cipher](#vigenere-cipher). There is no default key, meaning that `beaufort` as the encoding scheme throws a `LookupError` indicating that the _key must be a non-empty alphabetic string_.
+
+**Codec** | **Conversions** | **Aliases** | **Comment**
+:---: | :---: | --- | ---
+`beaufort` | text <-> Beaufort ciphertext | `beaufort-abcdef`, `beaufort_MySuperSecret` | key only consists of characters, not digits
+
+```python
+>>> codext.encode("This is a test !", "beaufort-abababa")
+'Husj sj a hxii !'
+>>> codext.encode("This is a test !", "beaufort_MySuperSecret")
+'Trkc hm r zaky !'
+>>> codext.decode("Husj sj a hxii !", "vigenere-abababa")
+'This is a test !'
+```
+
+-----
+
 ### Citrix CTX1
 
 This implements the Citrix CTX1 password encoding algorithm.
@@ -126,6 +162,25 @@ This implements the Citrix CTX1 password encoding algorithm.
 
 -----
 
+### Phillips Cipher
+
+This implements Phillips cipher, a polyalphabetic code using 8 grids generated with one keyword.
+
+**Codec** | **Conversions** | **Aliases** | **Comment**
+:---: | :---: | --- | ---
+`phillips` | text <-> phillips ciphertext | `phillips-key`, `phillips_password`, ... |
+
+```python
+>>> codext.encode("this is a test", "phillips_mysuperkey")
+'ZCNM NM E XKMVZ'
+>>> codext.encode("Another Test String", "phillips-PaSsWoRd")
+'SMEZKBE LBON OLEHQHV'
+>>> codext.decode("SMEZKBE LBON OLEHQHV", "phillips-password")
+'ANOTHER TEST STRINGX'
+```
+
+-----
+
 ### Polybius Square Cipher
 
 This implements the well-known Polybius Square cipher, using the square with the alphabet in normal order as the default. It can be used dynamically with a custom alphabet.

src/codext/VERSION.txt

@@ -1 +1 @@
-1.15.11
+1.16.3

src/codext/__common__.py

@@ -1,5 +1,6 @@
 # -*- coding: UTF-8 -*-
 import _codecs
+import builtins
 import codecs
 import hashlib
 import json
@@ -20,22 +21,6 @@
 from random import randint
 from string import *
 from types import FunctionType, ModuleType
-try:  # Python2
-    import __builtin__ as builtins
-except ImportError:
-    import builtins
-try:  # Python2
-    from inspect import getfullargspec
-except ImportError:
-    from inspect import getargspec as getfullargspec
-try:  # Python2
-    from string import maketrans
-except ImportError:
-    maketrans = str.maketrans
-try:  # Python3
-    from importlib import reload
-except ImportError:
-    pass
 try:
     import re._parser as sre_parse
 except ImportError:
@@ -44,6 +29,8 @@
 # from Python 3.11, 'sre_parse' is bound as '_parser' ; monkey-patch it for backward-compatibility
 re.sre_parse = sre_parse
 
+maketrans = str.maketrans
+
 
 __all__ = ["add", "add_macro", "add_map", "b", "clear", "codecs", "decode", "encode", "ensure_str", "examples", "guess",
            "isb", "generate_strings_from_regex", "get_alphabet_from_mask", "handle_error", "hashlib", "i2s",
@@ -277,6 +264,7 @@ def getregentry(encoding):
                 # this occurs while m is not None, but possibly no capture group that gives at least 1 group index ;
                 #  in this case, if fenc/fdec is a decorated function, execute it with no arg
                 if len(args) == 0:
+                    from inspect import getfullargspec
                     if fenc and len(getfullargspec(fenc).args) == 1:
                         fenc = fenc()
                     if fdec and len(getfullargspec(fdec).args) == 1:
@@ -683,7 +671,7 @@ def list_categories():
             c.append(d.rstrip("s"))
     # particular category, hardcoded from base/_base.py
     c += ["base-generic"]
-    return c
+    return list(set(c))
 list_categories()
 
 
@@ -767,6 +755,7 @@ def remove(name):
 
 def reset():
     """ Reset codext's local registry of search functions and macros. """
+    from importlib import reload
     global __codecs_registry, CODECS_REGISTRY, MACROS, PERS_MACROS  # noqa: F824
     clear()
     d = os.path.dirname(__file__)
@@ -1142,9 +1131,8 @@ def generate_string_from_regex(regex):
 
 def generate_strings_from_regex(regex, star_plus_max=STAR_PLUS_MAX, repeat_max=REPEAT_MAX, yield_max=YIELD_MAX):
     """ Utility function to generate strings from a regex pattern. """
-    i = 0
-    for result in __gen_str_from_re(regex, star_plus_max, repeat_max, yield_max):
-        yield result
+    for r in __gen_str_from_re(regex, star_plus_max, repeat_max, yield_max):
+        yield r
 
 
 # guess feature objects

src/codext/__init__.py

@@ -170,7 +170,7 @@ def _format_action_invocation(self, action):
     listi = sparsers.add_parser("list", help="list items")
     lsparsers = listi.add_subparsers(dest="type", help="type of item to be listed", required=True)
     liste = lsparsers.add_parser("encodings", help="list encodings")
-    liste.add_argument("category", nargs="+", help="selected categories")
+    liste.add_argument("category", nargs="*", help="selected categories")
     listm = lsparsers.add_parser("macros", help="list macros")
     addm = sparsers.add_parser("add-macro", help="add a macro to the registry")
     addm.add_argument("name", help="macro's name")
@@ -198,13 +198,13 @@ def _format_action_invocation(self, action):
         # list encodings or macros
         elif args.command == "list":
             if args.type == "encodings":
-                cats = args.category or list_categories()
-                for c in sorted(cats):
-                    l = list_encodings(c)
-                    if len(l) > 0:
-                        if len(cats) > 0:
+                if args.category:
+                    for c in sorted(args.category):
+                        if len(l := list_encodings(c)) > 0:
                             print(c.upper() + ":")
-                        __print_tabular(l)
+                            __print_tabular(l)
+                else:
+                    __print_tabular(list_encodings())
             elif args.type == "macros":
                 l = list_macros()
                 if len(l) > 0: